View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7812_high_14 (Length: 257)
Name: NF7812_high_14
Description: NF7812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7812_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 29428139 - 29427958
Alignment:
| Q |
15 |
tattattcttatgatattattacctccttggttggtgttgtatggttgttagttaggaaattcataacatattcaatgct-------tgttcagattgct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
29428139 |
tattattcttatgatattattacctccttggttggtgttgtatggttgttagttaggaaattcataatatattcaatgcttgttatttgttaagattgct |
29428040 |
T |
 |
| Q |
108 |
gtaaaattagtcaggaaaag-aaaaggtaagagctgagcaggatact-agctaagttatttgatgtgtatgcaactgcaaac |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29428039 |
gtaaaattagtcaggaaaagaaaaaggtaagagctgagcaggatactgagctaagttatttgatgtgtatgcaactgcaaac |
29427958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 239
Target Start/End: Complemental strand, 29427950 - 29427916
Alignment:
| Q |
205 |
acaaccttgtatcaagcttgtattagttaaatagt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427950 |
acaaccttgtatcaagcttgtattagttaaatagt |
29427916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University