View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7812_high_16 (Length: 237)
Name: NF7812_high_16
Description: NF7812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7812_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 2786201 - 2786411
Alignment:
| Q |
11 |
agtttggtgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttcgcatcaacaggtggattgacagc |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2786201 |
agtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttagcatcaaccggtggattgacagc |
2786300 |
T |
 |
| Q |
111 |
tccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786301 |
tccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagca |
2786400 |
T |
 |
| Q |
211 |
tcataaaactg |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
2786401 |
tcataaaactg |
2786411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 174
Target Start/End: Complemental strand, 22517521 - 22517462
Alignment:
| Q |
115 |
gcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaata |
174 |
Q |
| |
|
||||||||||||||||| ||||||||||| | | ||||||||| ||| |||||||||||| |
|
|
| T |
22517521 |
gcattgtagatggctttaattttgggaagttgttttgggcagacgaccgatagagaaata |
22517462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 22518281 - 22518232
Alignment:
| Q |
29 |
gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga |
78 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
22518281 |
gactcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga |
22518232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 22517356 - 22517315
Alignment:
| Q |
180 |
ctgcggaaatgctttagcaacatcttcagcatcataaaactg |
221 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
22517356 |
ctgcggaaacgctttagcaacagcttcagcatcatataactg |
22517315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University