View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7812_high_16 (Length: 237)

Name: NF7812_high_16
Description: NF7812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7812_high_16
NF7812_high_16
[»] chr1 (1 HSPs)
chr1 (11-221)||(2786201-2786411)
[»] chr5 (3 HSPs)
chr5 (115-174)||(22517462-22517521)
chr5 (29-78)||(22518232-22518281)
chr5 (180-221)||(22517315-22517356)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 2786201 - 2786411
Alignment:
11 agtttggtgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttcgcatcaacaggtggattgacagc 110  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||    
2786201 agtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttagcatcaaccggtggattgacagc 2786300  T
111 tccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2786301 tccagcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagca 2786400  T
211 tcataaaactg 221  Q
    |||||||||||    
2786401 tcataaaactg 2786411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 174
Target Start/End: Complemental strand, 22517521 - 22517462
Alignment:
115 gcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaata 174  Q
    ||||||||||||||||| ||||||||||| | | ||||||||| ||| ||||||||||||    
22517521 gcattgtagatggctttaattttgggaagttgttttgggcagacgaccgatagagaaata 22517462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 22518281 - 22518232
Alignment:
29 gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga 78  Q
    ||||||||||| ||||||||||||| |||||||||||||| |||| ||||    
22518281 gactcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga 22518232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 22517356 - 22517315
Alignment:
180 ctgcggaaatgctttagcaacatcttcagcatcataaaactg 221  Q
    ||||||||| |||||||||||| ||||||||||||| |||||    
22517356 ctgcggaaacgctttagcaacagcttcagcatcatataactg 22517315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University