View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7812_high_17 (Length: 205)
Name: NF7812_high_17
Description: NF7812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7812_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 38657104 - 38656929
Alignment:
| Q |
1 |
acgttagtgtattgtttcatgtcatgt-----gtgtgccgtggtgataatctaaggactcattgtgtagaataaaatgtgcacattatgtttgccgaatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38657104 |
acgttagtgtattgtttcatgtcatgtcatgtgtgtgccgtggtgataatctaaggactcattgtgtagaataaaatgtgcacattatgtttgtcgaatt |
38657005 |
T |
 |
| Q |
96 |
taatgatcaagcttttccttctccgtaagtaagattcattgtgcacaaggcgcatgaagcaaatgcaaaatcattt |
171 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38657004 |
taatgatcaagcttttccttctctgtaagtaagattcattgtgcacaaggcgcatgaagcaaatgcaaaatcattt |
38656929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University