View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7814_high_13 (Length: 373)
Name: NF7814_high_13
Description: NF7814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7814_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 56159429 - 56159209
Alignment:
| Q |
13 |
aatattataatcgtaataaattgttttgattcagttttaacactactacaatgataaatgaaaggcaaaacacaaagcacactaaataaaagcatataaa |
112 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56159429 |
aatattataatcgtaatcaattgttttcattcagttttaacactac---aatgataaatgaaaggcaaaacacaaagcacactaaataaaagcatataaa |
56159333 |
T |
 |
| Q |
113 |
tgttgaagaattatgaagtctagcttttattcaggataaaagttgctgcctgcatactgatgtgaaaaacttgacacttattattttcataaatagtaat |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56159332 |
tgttgaa---ttatgaagtctagcttttattcaggataaaagttgctgcctgcatactgatgtgaaaaactt--cacttattattttcataaatagtaat |
56159238 |
T |
 |
| Q |
213 |
ggacctaatttcgttgttactattacaat |
241 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
56159237 |
ggacctaattttattgttactattacaat |
56159209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 56159048 - 56159006
Alignment:
| Q |
313 |
tcatttaaacttgggcttgaaacaacataaaactgaatcattt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56159048 |
tcatttaaacttgggcttgaaacaacataaaactgaatcattt |
56159006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University