View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7814_high_43 (Length: 228)
Name: NF7814_high_43
Description: NF7814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7814_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 27245623 - 27245413
Alignment:
| Q |
1 |
agtattatcctgtcttgtaataataatgataaaggtctatgtatgtgtgtcactttcaatggcttttgtgggtcaaagaatggaagtctgtctattcca- |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245623 |
agtattatcctgtcttgcaataataatgataaaggtctatgtatgtgtgtcactttcaatggcttttgtgggtcaaagaatggaagtctgtctattccaa |
27245524 |
T |
 |
| Q |
100 |
cgttcttatgatatgcttatgatatttggccccttcatggtgaggttggtacttacctcctttttgtatccattaggttggaatatttaagagattttaa |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245523 |
cgttcttatgatgtgcttatgatatttggccccttcatggtgaggttggtacttacctccattttgtatccattaggttggaatatttaagagattttaa |
27245424 |
T |
 |
| Q |
200 |
tggcttgtttg |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
27245423 |
tggcttgtttg |
27245413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University