View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7814_low_32 (Length: 257)
Name: NF7814_low_32
Description: NF7814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7814_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 40469997 - 40469752
Alignment:
| Q |
10 |
atatgaaggaaaacacaaccatgagatgccactcaagaacacaacaa--------tctgaaaaagattcaatgacttctcttaagtaaagataaaccata |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40469997 |
atatgaaggaaagcacaaccatgagatgccactcaagaacacaacaaatatgacatctgaaaaagattcaacgacttctcttaagtaaagataaaccata |
40469898 |
T |
 |
| Q |
102 |
ttgacactacactttcatttattagttaacaataacagtatagttattatgactaaatgctttggatcctcttatagatggtgacaatttggaatgtagt |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40469897 |
ttgacactacattttcatttattagttaacaataacagtatagttattatgactaaatgctttggatcctcttatagatggtgacaatttggaatgtagt |
40469798 |
T |
 |
| Q |
202 |
aactacagagactaggttatttactttctgttgcaacatttgatga |
247 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40469797 |
aactacagagactgggttatttactttctgttgcaacatttgatga |
40469752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University