View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7814_low_45 (Length: 237)
Name: NF7814_low_45
Description: NF7814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7814_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 42546370 - 42546584
Alignment:
| Q |
17 |
cttgcgaaaccatttaaaaaatcgtctacgtacatgtaaatttcatagaaaatatgactttgatattttatcagttccacatcaagaatatcactcttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546370 |
cttgcgaaaccatttaaaaaatcgtctacgtacacgtaaatttcatagaaaatatgactttgatattttatcagttccacatcaagaatatcactcttct |
42546469 |
T |
|
| Q |
117 |
aaaatatccattgttccgtgtataattgtcaagctaaaggcatgattgctgattcaatatattggaacattacatcaataaacaataaaccattcaatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546470 |
aaaatatccattgttccgtgtataattgtcaagctaaaggcatgatcgctgattcaatatattggaacattacatcaataaacaataaaccattcaatta |
42546569 |
T |
|
| Q |
217 |
cttgaatgatcacta |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42546570 |
cttgaatgatcacta |
42546584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University