View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7814_low_46 (Length: 236)
Name: NF7814_low_46
Description: NF7814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7814_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 72 - 218
Target Start/End: Original strand, 29061476 - 29061621
Alignment:
| Q |
72 |
gatagtgaaagcaatcaaaacactttcaaggatcatcattactctctttattcttgactttgacaatatcaagcagtgcgggtaactacatcttatatct |
171 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29061476 |
gatagggaaagcaatcaaaacactttcaaggatcatcattactctctttattctttactttgacaatatcaagcagtgcgggtaactacatc-tatatcc |
29061574 |
T |
|
| Q |
172 |
attggccattcatagtgcctcagaagtatacacccaattgagaaatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29061575 |
attggccattcatagtgcctcagaagtatacgcccaattgagaaatt |
29061621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University