View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7816_high_10 (Length: 383)
Name: NF7816_high_10
Description: NF7816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7816_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 196 - 352
Target Start/End: Original strand, 31660310 - 31660447
Alignment:
| Q |
196 |
gatctataatcattccattaagtatgtaatgatatatatgtatgtctagatgtctagctgtgttgcagattaaaaggatcaaattctactctaggcatca |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31660310 |
gatctataatcattccattaagtatgtaatgataattatgtatgtttagatgtctagctgtgttgcagattaaaagg-------------------atca |
31660390 |
T |
 |
| Q |
296 |
catgacatgttattttttattcttaaattcgtcctttaaggatacagcacatctcct |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31660391 |
catgacatgttattttttattcttaaattcgtcctttaaggatacagtacatctcct |
31660447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 31660130 - 31660184
Alignment:
| Q |
16 |
aatattgaggtgcttttttcccaagttggtgaaattgaccttaagtaatgaagac |
70 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31660130 |
aatattgaggtccttttttcccaagttggtgaaattgaccttaagtaatgaagac |
31660184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University