View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7816_high_20 (Length: 228)

Name: NF7816_high_20
Description: NF7816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7816_high_20
NF7816_high_20
[»] chr2 (1 HSPs)
chr2 (21-198)||(31660459-31660636)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 31660459 - 31660636
Alignment:
21 gatacaagacatatattccctaacgaaagaaaactgacaagtatacttttgttttgttagggaggtggcaataaaagtataaaagaatgaaaaatctgga 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||    
31660459 gatacaagacatatattccctaacgaaagaaaactgacaagtatacttttgttttgttagggaggtggcaataaaagtataaaagaatgaaaaggctgga 31660558  T
121 gaattaattagagcgatgataaatatacaaattgccaatatagaataatggtttgtgtacccaatcccacgtgaatta 198  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||    
31660559 gaattaattagagcgatgataaatatacaaattggcaatatagaataatggtttgtgtacccaatcccacatgaatta 31660636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University