View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7816_low_14 (Length: 330)
Name: NF7816_low_14
Description: NF7816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7816_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 51453231 - 51452987
Alignment:
| Q |
18 |
acttccaccatattcttttaaagaattaataatgaccatttcgtgcattatgtttcttttggttactataacattttcactactgttatcaaataactaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51453231 |
acttccaccatattcttttaaagaattaataatgaccatttcgtgcattatgtttcttttggt----ataacattttcactactgttatcaaataactaa |
51453136 |
T |
|
| Q |
118 |
tctttgttacaaatttgttggacacagttcttcacttttaaacaagat--------------gagctaatgatctaacctttgatga-nnnnnnnngggg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
51453135 |
tctttgttacaaatttgttggacacagttcttcacttttaaacaagatttctcagtataccagagctaatgatctaacctttgatgatttttttttgggg |
51453036 |
T |
|
| Q |
203 |
tttaaatctttaccatttagactaatcaattgttagtattatgttgttc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51453035 |
tttaaatctttaccatttagactaatcaattgttagtattatgttgttc |
51452987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University