View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7816_low_23 (Length: 230)

Name: NF7816_low_23
Description: NF7816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7816_low_23
NF7816_low_23
[»] chr4 (1 HSPs)
chr4 (1-222)||(39305574-39305795)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 39305795 - 39305574
Alignment:
1 gtcttgctacatccgtaatttaacaactctgctgcaaatactgactttggcactggggctaaagagcaagtatcttgaaggtggttcagtcaaatctatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
39305795 gtcttgctacatccgtaatttaacaactctgctgcaaatactgactttggcactgtggctaaagagcaagtatcttgaaggtggttcagtcaaatctatg 39305696  T
101 ggatgctgtcatagtgctaataagtcagcttaggctaacaacatggaccctccctttcggtggttcagctaagcttcaccattaactgttttagtgttta 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39305695 ggatgctgtcatagtgctaataagtcagctgaggctaacaacatggaccctccctttcggtggttcagctaagcttcaccattaactgttttagtgttta 39305596  T
201 agttaaagctcagtttcttctc 222  Q
    ||||||||||||||||||||||    
39305595 agttaaagctcagtttcttctc 39305574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University