View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7816_low_25 (Length: 206)
Name: NF7816_low_25
Description: NF7816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7816_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 25 - 188
Target Start/End: Complemental strand, 10036898 - 10036735
Alignment:
| Q |
25 |
agttctgtacctttccatctctgatagaaatctcagcaactcctgcaaaacagaaaactctcaaggagatttcccgggggacaacttatacattgttaaa |
124 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10036898 |
agttctttacctttccatctctgatagaaatctcagcaactcctgcaaaacagaaaactctcaaggagatttcccaggggacaacttatacattgttaaa |
10036799 |
T |
 |
| Q |
125 |
atctcaaaataaatatataaaaaagacgaagaagaaagaatgtaataccatcagggcctgcaac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036798 |
atctcaaaataaatatataaaaaagacgaagaagaaagaatgtaataccatcagggcctgcaac |
10036735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University