View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7817_low_5 (Length: 285)
Name: NF7817_low_5
Description: NF7817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7817_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 27201220 - 27201499
Alignment:
| Q |
1 |
tctcaatagtggtgattcttgttttgtgtataatgcctnnnnnnntggctttgaacttacatcataacctatttttcttctttattatgttggtttctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27201220 |
tctcaatagtggtgattcttgttttgtgtataatgcctaaaaaaatggctttgaacttacatcataacctatttttcttctttattatgttggtttctat |
27201319 |
T |
|
| Q |
101 |
cttgttcatggcttctgctcaattatcttcagatttctatggaacaacatgccctaaagccctttctatcataaactctgcagtgtgtagtgctgtttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
27201320 |
cttgttcatggcttctgctcaattatcttcagatttttatggaacaacatgccctaaagccctttctatcataaactctgcggtgtgcagtgctgtttct |
27201419 |
T |
|
| Q |
201 |
aaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatgcacgttctttcttctctct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27201420 |
aaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatgcacgttctttcttctctct |
27201499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 213 - 261
Target Start/End: Original strand, 52301198 - 52301246
Alignment:
| Q |
213 |
atgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatg |
261 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
52301198 |
atgggtgcttctttgcttcgtcttcactttcatgattgctttgtcaatg |
52301246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 256
Target Start/End: Complemental strand, 10084420 - 10084355
Alignment:
| Q |
191 |
tgctgtttcgaaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgctttgt |
256 |
Q |
| |
|
|||||| |||| ||| | |||| | ||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
10084420 |
tgctgtgtcgagagatcgtcgcttaggtgcatccttgctccgtcttcatttccatgattgctttgt |
10084355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 261
Target Start/End: Complemental strand, 17549506 - 17549458
Alignment:
| Q |
213 |
atgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatg |
261 |
Q |
| |
|
|||| |||||| |||||||||||||| || |||||||||||||| |||| |
|
|
| T |
17549506 |
atggctgcttctttgcttcgtcttcactttcatgattgctttgtaaatg |
17549458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 261
Target Start/End: Original strand, 23229807 - 23229839
Alignment:
| Q |
229 |
ttcgtcttcatttccatgattgctttgtcaatg |
261 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
23229807 |
ttcgtcttcattttcatgattgctttgtcaatg |
23229839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University