View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7817_low_8 (Length: 256)
Name: NF7817_low_8
Description: NF7817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7817_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 49735541 - 49735307
Alignment:
| Q |
9 |
agacaggaaaaaggcagggtatagttagtggagttggttttggcttatcaatcttctttatgttctgtgtttatgcatgcagtttttatgctggagcaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49735541 |
agacaggaaaaaggcagggtatagttagtggagttggttttggcttatcaatcttctttatgttctgtgtttatgcatgcagtttttatgctggagcaca |
49735442 |
T |
 |
| Q |
109 |
acttgttaagaatggcaaaacctcaatatcagatgtttttcaagtaagttattgtccaaacttggatgctatgtcacatatagaggacaaagttcagaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49735441 |
acttgttaagaatggcaaaacctcaatatcagatgtttttcaagtaagttattgtccaaacttggatgctatgtcacatatagaggacaaagttcagaat |
49735342 |
T |
 |
| Q |
209 |
tgtccaaatttaagttttttacttatgtcaattgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49735341 |
tgtccaaatttaagttttttacttatgtcaattgt |
49735307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 9 - 159
Target Start/End: Original strand, 51214568 - 51214718
Alignment:
| Q |
9 |
agacaggaaaaaggcagggtatagttagtggagttggttttggcttatcaatcttctttatgttctgtgtttatgcatgcagtttttatgctggagcaca |
108 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||| |||| ||||| |||||| ||||||||||||||| || || |
|
|
| T |
51214568 |
agacaggaaaaaggcagggtttagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgccca |
51214667 |
T |
 |
| Q |
109 |
acttgttaagaatggcaaaacctcaatatcagatgtttttcaagtaagtta |
159 |
Q |
| |
|
|||| || ||||||||||||| || || |||| ||||||||||||||||| |
|
|
| T |
51214668 |
acttattgagaatggcaaaacttcgatgtcaggagtttttcaagtaagtta |
51214718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University