View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7819_low_12 (Length: 223)
Name: NF7819_low_12
Description: NF7819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7819_low_12 |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0100 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 48365 - 48566
Alignment:
| Q |
8 |
cgaagaatatttatcaattttattgatgatttgtcacttttagtaaaatctgttcttgtttcttaattcataagatttgattgataaataaataactata |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48365 |
cgaagcatatttatcaattttattgatgatttgtcacttttagtaaaatctgttcttgtttcttaattcataagatttgattgataaataaatagctata |
48464 |
T |
 |
| Q |
108 |
gaaaatgtttatgcaaaatgtccactcaaactagatttacaaattacaatattgcctgatgattgataatttttcacattaatagtgtattgtcattttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48465 |
gaaaatgtttatgcaaaatgtccactcaaactagatttacaaattacaatattgcctgatgattgataatttttcacattaatagtgtattgtcattttt |
48564 |
T |
 |
| Q |
208 |
aa |
209 |
Q |
| |
|
|| |
|
|
| T |
48565 |
aa |
48566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University