View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7820_high_5 (Length: 400)
Name: NF7820_high_5
Description: NF7820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7820_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 6 - 384
Target Start/End: Original strand, 6354064 - 6354447
Alignment:
| Q |
6 |
gagggatgggtccaatactttcttttggcgggactcttggttggatttatttcttttaatgttaggttcaaaaggnnnnnnngagttagatgaaaataaa |
105 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6354064 |
gagggatgggtccaataatttgttttggcgggactcttggttggatttatttcttttaatgttaggttcaaaaggtttttt-gagttagatgaaaataaa |
6354162 |
T |
|
| Q |
106 |
ttgacaactgtagctcaaatgcattctctagggtgaggagagagtgaggaggcgtgattcgcgaaaatggcgtatgaggttgttcgctt---aggaggag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6354163 |
ttgacaactgtagctcaaatgcattctctagggtgaggagagagtgagggggcgtgattcgcgaaaatggcgtatgaggttgttcgcttaggaggaggag |
6354262 |
T |
|
| Q |
203 |
tagacgggtgagtgtgttgagctgctaccataa---nnnnnnnngcaggttgatgtggaggatcgttggatttagaagttacatgcttttcagtgttaca |
299 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6354263 |
tagacgggggagtgtgttgagctgctaccataaattttttttttgcaggttgatgtggaggatcgttggatttagaagttacatgctttttagtgttaca |
6354362 |
T |
|
| Q |
300 |
ctgtgagtagtgtttataacaatttaactacaattccgcaatcgtcttcatactaaggacaatttggcaaggcgaaggattatta |
384 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354363 |
ctgtgggtagtgtttataacaatttaactacaattccgcaatcatcttcatactaaggacaatttggcaaggcgaaggattatta |
6354447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 344 - 384
Target Start/End: Complemental strand, 20255801 - 20255761
Alignment:
| Q |
344 |
tcttcatactaaggacaatttggcaaggcgaaggattatta |
384 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20255801 |
tcttcttactaaggataatttggcaaggcgaaggattatta |
20255761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University