View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7820_low_12 (Length: 247)
Name: NF7820_low_12
Description: NF7820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7820_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 33126972 - 33127189
Alignment:
| Q |
1 |
tccactataccagaagaaacttcnnnnnnncatgacaacaatttctggtttttcgtcttccaaaactctttcggctaaactaacatgatagatcataata |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33126972 |
tccactataccagaagaaacttgtttttttcatgacaacaatttctggtttttcgtcttccaaaactctttcggctaaactaacgtgatagatcataata |
33127071 |
T |
 |
| Q |
101 |
agactccacgagactagccatataattgttgatacttctcttgatattgccatctttttaacttctaaagccatgtatgaacggtttgaagc-aatattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33127072 |
agactccacgagactagccatataattgttgataattctcttgatattgccatctttttaacttctaaagccatgtatgaacggtttgaagcaaatattt |
33127171 |
T |
 |
| Q |
200 |
agttaggactctagtatg |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33127172 |
agttaggactctagtatg |
33127189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University