View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7820_low_9 (Length: 316)
Name: NF7820_low_9
Description: NF7820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7820_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 42545202 - 42544966
Alignment:
| Q |
14 |
ttctagaagattactttgcatttgtttttcatagtttatcttttgttataggtgcatgtttgtgcaatcttttatgcatgagtagtcatattaacttgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42545202 |
ttctagaagattactttgcatttgtttttcatagtttatcttttgtta--ggtgcatgcttgtgcaatcttttatgcatgattagtcatattaacttgat |
42545105 |
T |
|
| Q |
114 |
gtttgactcaaactaagtagcagttgttgagccttttgggttttttggcttgctcgtgcaacgaattgtccctctaacaaaaggcagctttaagcttgtt |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42545104 |
gtttgactcaaactaagtagtagttgttgagccttttgggttttttggcttgctcgtgcaacgaattgtccctctaacaaaaggcagctttaagcttgtt |
42545005 |
T |
|
| Q |
214 |
cacgtaaatttaaatccaagttatgtcattgaatttcga |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42545004 |
cacgtaaatttaaatccaagttatgtcattgaatttcga |
42544966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University