View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7821_high_7 (Length: 223)
Name: NF7821_high_7
Description: NF7821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7821_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 43229833 - 43229625
Alignment:
| Q |
12 |
attatactaaatacagagtcatttttggtacagccaaacatattgataatgcttaccatacctctgattttgatccgagttcatgccttaactttttctt |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43229833 |
attatactaaatacacagtcatttttggtacagccaaacagattgataatgcttaccatacctctgattttgatccgagttcatgccttaactttttctt |
43229734 |
T |
 |
| Q |
112 |
ttccccctcatcctttctatggataatctgatttaaaccatggttactggtttatgtttgatagaaaagatttgcaacatattttgtacatagttttgat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43229733 |
ttccccctcatcctttctatggataatctgatttaaaccatggttactggtttatgtttgatagaaaagatttgcaacatattttgtacatagttttgac |
43229634 |
T |
 |
| Q |
212 |
gtccatctc |
220 |
Q |
| |
|
|||| |||| |
|
|
| T |
43229633 |
gtccttctc |
43229625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University