View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7821_low_8 (Length: 243)
Name: NF7821_low_8
Description: NF7821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7821_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 74 - 243
Target Start/End: Original strand, 3855498 - 3855669
Alignment:
| Q |
74 |
ttaaaatgatattaataataaatctatttaacgaattaaatggaaacttatattttaaggacactttttaaaattggacttatacttaagggcatggtac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
3855498 |
ttaaaatgatattaataataaatctatttaacgaattaaatggaaacttatattttaaggacacttttaaaagttggacttatacttaagggcatggtac |
3855597 |
T |
 |
| Q |
174 |
atggtagatataataacttatttcaaagtttaaacaatagttg--ataaaataaaaagatagaatgtatact |
243 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3855598 |
atagtagatataataacttatttcaaagtttaaacaatagttgatataaaataaaaagatagaatgtatact |
3855669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University