View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7822_high_10 (Length: 209)

Name: NF7822_high_10
Description: NF7822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7822_high_10
NF7822_high_10
[»] chr5 (2 HSPs)
chr5 (107-193)||(1067837-1067924)
chr5 (1-62)||(1067768-1067829)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 1067837 - 1067924
Alignment:
107 tcactccatggatgcaaacctcgttggcttt-ctcattatccccgcacttctcttcgtttcattcatttcactcttactatgtttcct 193  Q
    ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1067837 tcactccatggatgcaaacctcgctggcttttctcattatccccgcacttctcttcgtttcattcatttcactcttactatgtttcct 1067924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1067768 - 1067829
Alignment:
1 attgttctgttctgttctgttacaaacagcaccatgaaactctttctctctctctaacctct 62  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||    
1067768 attgttctgttctgttctgttacaaacagcaccgtgaaactctttctctttctctaacctct 1067829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University