View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7822_high_9 (Length: 232)
Name: NF7822_high_9
Description: NF7822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7822_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 1067686 - 1067472
Alignment:
| Q |
1 |
tccaaccaacattttcttgcaaaaaattagtgttgtgtccgatgttagaatttgtctcagttttatagtgtgattggttagtgtccattgtctggctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1067686 |
tccaaccaacattttcttgcaaaaaattagtgttgtgtccgatgttagaatttgtctcagttttatagtgtgattggttactgtccattgtctggctatt |
1067587 |
T |
 |
| Q |
101 |
tttcatgaaatttcaggtgtaccgtgattggaaatttattcaattgtaaggtctggtttggaggcttttgattctaattgtttttgattggttagcacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1067586 |
tttcatgaaatttcaggtgtaccgtgattggaaatttattcaattgtaaggtctggtttggaggcttttgattctaattgtttttgattggttagcacca |
1067487 |
T |
 |
| Q |
201 |
gcatttctaaacaaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1067486 |
gcatttctaaacaaa |
1067472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 77 - 146
Target Start/End: Complemental strand, 1067234 - 1067165
Alignment:
| Q |
77 |
gttagtgtccattgtctggctatttttcatgaaatttcaggtgtaccgtgattggaaatttattcaattg |
146 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||||||| |||| ||| |||||||||||||| |||| |
|
|
| T |
1067234 |
gttactgtccattatctggttatttttcatgaaatttcagatgtatagtggttggaaatttattccattg |
1067165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University