View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7822_low_10 (Length: 209)
Name: NF7822_low_10
Description: NF7822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7822_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 1067837 - 1067924
Alignment:
| Q |
107 |
tcactccatggatgcaaacctcgttggcttt-ctcattatccccgcacttctcttcgtttcattcatttcactcttactatgtttcct |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1067837 |
tcactccatggatgcaaacctcgctggcttttctcattatccccgcacttctcttcgtttcattcatttcactcttactatgtttcct |
1067924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1067768 - 1067829
Alignment:
| Q |
1 |
attgttctgttctgttctgttacaaacagcaccatgaaactctttctctctctctaacctct |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1067768 |
attgttctgttctgttctgttacaaacagcaccgtgaaactctttctctttctctaacctct |
1067829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University