View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7823_high_14 (Length: 240)
Name: NF7823_high_14
Description: NF7823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7823_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 106 - 224
Target Start/End: Original strand, 25480364 - 25480482
Alignment:
| Q |
106 |
ttcaactaggttttagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgtctggtgagtctcggattgtatttgaccctat |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25480364 |
ttcaactaggtttaagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgtctggtgagtctcagattgtatttgaccctat |
25480463 |
T |
|
| Q |
206 |
ggaaagaagaggtagtatg |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25480464 |
ggaaagaagaggtagtatg |
25480482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 106 - 224
Target Start/End: Complemental strand, 25863741 - 25863623
Alignment:
| Q |
106 |
ttcaactaggttttagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgtctggtgagtctcggattgtatttgaccctat |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25863741 |
ttcaactaggtttaagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgtctggtgagtctcagattgtatttgaccctat |
25863642 |
T |
|
| Q |
206 |
ggaaagaagaggtagtatg |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25863641 |
ggaaagaagaggtagtatg |
25863623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 96 - 207
Target Start/End: Complemental strand, 25606342 - 25606231
Alignment:
| Q |
96 |
ttaccagccattcaactaggttttagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgtctggtgagtctcggattgtat |
195 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
25606342 |
ttaccagccatacaactaggtttaagttttacaatgcttgagaaggttaaaaggaaacatgacaaaaaggaaaatatgcatagtgagtctcggattgtat |
25606243 |
T |
|
| Q |
196 |
ttgaccctatgg |
207 |
Q |
| |
|
|| | ||||||| |
|
|
| T |
25606242 |
ttcatcctatgg |
25606231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 25606486 - 25606452
Alignment:
| Q |
9 |
aaatgaattggtacaaatatcgacttccttagagt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25606486 |
aaatgaattggtacaaatatcgacttccttagagt |
25606452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University