View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7824_high_36 (Length: 252)
Name: NF7824_high_36
Description: NF7824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7824_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 244
Target Start/End: Original strand, 25840902 - 25841124
Alignment:
| Q |
22 |
ctcagtttcacgttgaacccttcttttattggttcccattcatatttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840902 |
ctcagtttcacgttgaacccttcttttattggttcccattcatatttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgc |
25841001 |
T |
|
| Q |
122 |
cgaggagaaatggcgtgtctgtcgcggttaggtaacggccgtggtggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgattaaccatag |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25841002 |
cgaggagaaatggcgtgtccgtcgcggttaggtaacggccatggtggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgataaaccatag |
25841101 |
T |
|
| Q |
222 |
tgattttttggttgtttcatttc |
244 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
25841102 |
tgattttttggttgttccatttc |
25841124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University