View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7825_high_3 (Length: 316)
Name: NF7825_high_3
Description: NF7825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7825_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 42238914 - 42239214
Alignment:
| Q |
1 |
taacaccatctgttttaacaattgataatagttcctgtaatgacatttctttggtcactaactgttgaagctgctgtttcgttattaaaactttgattct |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42238914 |
taacaccatctgttttaacaactgataatagttcctgtaatgacatttctttggtcactaactgttgaagctgctgtttcgttattaaaactttgatcct |
42239013 |
T |
|
| Q |
101 |
ctttgtctttgtcccaccaccaccttgttcttctgcctctttgttatgtggaatcaagtagtacaattttccacccttcaattcatgatcttgtgataga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42239014 |
ctttgtctttgtcccaccaccaccttgttcttctgcctctttgttatgtggaatcaagtagtacaattttccacccttcaattcatgatcttgtgataga |
42239113 |
T |
|
| Q |
201 |
gtttctgttgcattcttcgaatcaacaatagcagcattagtaggaaaatttatcaaaatgtctttcacatggattggtgaactaaactctagcatcttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42239114 |
gtttctgttgcattcttcgaatcaacaatagcagcattagtaggaaaatttatcaaaatgtctttcacatggattggtgaactaaactctagtatcttac |
42239213 |
T |
|
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
42239214 |
c |
42239214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University