View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7825_low_4 (Length: 270)
Name: NF7825_low_4
Description: NF7825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7825_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 30944012 - 30943812
Alignment:
| Q |
1 |
tttgttattacttttagaacattatatgagactatacctannnnnnnggtataatataactactttttt-aattgatgtgaaagttgttatttttacgta |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
30944012 |
tttgttattacttttggaacattatatgagactataccaatttttttggtataatataactactttttttaattgat--------------ttttacgta |
30943927 |
T |
 |
| Q |
100 |
ctagtatatttgaaactaagaatattgaaattgtgtattagaggtggtagatagttcaacttatttgacttgaggaataagaagtttaagattttgggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30943926 |
ctagtatatttgaaactaagaatattgaaattgtgtattagaggaggtagatagttcaaccgatttgacttgaggaataagaagtttaagattttgggtt |
30943827 |
T |
 |
| Q |
200 |
aaagctcggacaaag |
214 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
30943826 |
aaagttcggacaaag |
30943812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University