View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_high_32 (Length: 332)
Name: NF7826_high_32
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 6 - 316
Target Start/End: Original strand, 15920591 - 15920908
Alignment:
| Q |
6 |
aaaaaaggaagaagagaatcaaataatgaagccaattaggtttggaaatgatgcgaaagagatggaatatagggttgcaagatcttgcctgctatagaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15920591 |
aaaaaaggaagaagagaatcaaataatgaagccaattaggtttggaaatgatgtgaaagagatggaatatagggttgcaagatcttgcctgctatagaga |
15920690 |
T |
|
| Q |
106 |
ataagaaaggaatggggatgtgaataggacacgtttaatttaatgtgttccct-------ctctctataaggaaaaggaagagtgtaggaaagtgttgtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15920691 |
ataagaaaggaatggggatgtgaataggacacgtttaatttaatgtgttcccttccctgactctctataaggaaaaggaagagtgtaggaaagtgttgtg |
15920790 |
T |
|
| Q |
199 |
gggtcattggaactgttgtaattgtctagttgtctcaaatggagggtgtgctgaaaacattgcttgtgtcatgtggaaatggaaccagaatatttggttg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15920791 |
gggtcattggaactgttgtaattgtctagttgtctcaaatggaggatgtgctgaaaacattgcttgtgtcatgtggaaatggaaccagaatatttggttg |
15920890 |
T |
|
| Q |
299 |
ttgcttctttacttcttt |
316 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
15920891 |
ttgcttctttacttcttt |
15920908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University