View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_high_47 (Length: 243)
Name: NF7826_high_47
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 47355255 - 47355465
Alignment:
| Q |
13 |
aatatcataaacatattttagaagggtcttgaaaattgcttaattttttatttgtaggtgttggatgtgacaaagttcttggaggaacatccaggaggag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47355255 |
aatatcataaacatattttagaagggtcttgaaaattgcttaattttttatttgtaggtgttggatgtgacaaagttcttggaggaacatccaggaggag |
47355354 |
T |
 |
| Q |
113 |
aagaagtgatagtagaggttgcagggaaggatgcaacaaaggagtttgacgctgttggacacagtaaagcagctcaaaacttagtcctaaaataccaagt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47355355 |
aagaagtgatagtagaggttgcagggaaggatgcaacaaaggagtttgatgctgttggacacagtaaagtagctcaaaacttagtcctaaaataccaagt |
47355454 |
T |
 |
| Q |
213 |
gggtgtacttg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
47355455 |
gggtgtacttg |
47355465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University