View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_high_50 (Length: 241)
Name: NF7826_high_50
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 3982515 - 3982717
Alignment:
| Q |
1 |
cttttaattattcttatcaattcatacgttgtaggaatttcaatcatgcaagcgttagaaatggaaatctagatttgatttccgaatttcaagtggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982515 |
cttttaattattcttatcaattcatacgttgtaggaatttcaatcatgcaagggttagaaatggaaatctagatttgatttccgaatttcaagtggattt |
3982614 |
T |
 |
| Q |
101 |
gcgttattggaactggaaagtagtttcattctcgtatttaattattttgtggatcgattcagaatgtgaaaaatgcattttatgtttattgattctgtta |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982615 |
gcgttattggagctggaaagtagtttcattctcgtatttaattattttgtggattgcttcagaatgtgaaaaatgcattttatgtttattgattctgtta |
3982714 |
T |
 |
| Q |
201 |
tca |
203 |
Q |
| |
|
||| |
|
|
| T |
3982715 |
tca |
3982717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University