View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_high_52 (Length: 237)
Name: NF7826_high_52
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 52873003 - 52872902
Alignment:
| Q |
19 |
tgatcggcaagtttaggcaaaatagagccaaatttagcggtcatagcgttaagcatgtcaccttctttgccatcaacccaattcttcactttaacctgta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873003 |
tgatcggcaagtttaggcaaaatagagccaaatttagcggtcatagcgttaagcatgtcgccttctttgccatcaacccaattcttcactttaacctgta |
52872904 |
T |
|
| Q |
119 |
ac |
120 |
Q |
| |
|
|| |
|
|
| T |
52872903 |
ac |
52872902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 218
Target Start/End: Complemental strand, 52872847 - 52872804
Alignment:
| Q |
175 |
caagtaagaattaccaattgcgtttcgtgattgcatgcggcgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52872847 |
caagtaagaattaccaattgcgtttcgtgattgcatgcggcgtt |
52872804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University