View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_low_10 (Length: 540)
Name: NF7826_low_10
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 23 - 509
Target Start/End: Complemental strand, 36502837 - 36502347
Alignment:
| Q |
23 |
atgtgtgttggtgttggtgt--agtctggtgtttgtgtctgtaatcataggatgctaggtttgcttcattgatgttgtttttgtgtggtgattggttggt |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502837 |
atgtgtgttggtgttggtgtcgagtctggtgtttgtgtctgtaatcataggatgctaggtttgcttcattgatgttgtttttgtgtggtgattggttggt |
36502738 |
T |
 |
| Q |
121 |
gctaatagctgttttttgtctgcagctaaagaagaatgatattttgagcaatacaattcagacaaggtcaaaggcacacaacatcatcaagcgaatgctg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502737 |
gctaatagctgttttttgtctgcagctaaagaagaatgatattttgagcaatacaattcagacaaggtcaaaggcacacaacatcatcaagcgaatgctg |
36502638 |
T |
 |
| Q |
221 |
gccagtttgggcgatccttatacacgttttctttcacctgaggaggtaatgcattcttcaattttcattagtgttgctctgtggagatttttctttttat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502637 |
gccagtttgggcgatccttatacacgttttctttcacctgaggaggtaatgcattcttcaattttcattagtgttgctctgtggagatttttctttttat |
36502538 |
T |
 |
| Q |
321 |
cattagatgtttatgccttatgggc-acttgccttgcca-ccccctgatgtgagtcttgatattgcaaagagcaccgtcatatacaactgaggcgnnnnn |
418 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
36502537 |
cattagatgtttatgccttatgggctttttgccttgccacccccctgatgtgagtcttgatattgcaaagggcacggtcatatacaactgaggcgaaaaa |
36502438 |
T |
 |
| Q |
419 |
nntaaatctcatctgcattgcggtcacagacctgtnnnnnnnnccttgatgtttgtctgaacctacaattgcagctgctgaacagtttttt |
509 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502437 |
aataaatctcatctgcattgcggtcacagacctgtaaaaaaaaccttgatgtctgtctgaacctacaattgcagctgctgaacagtttttt |
36502347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University