View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_low_15 (Length: 460)
Name: NF7826_low_15
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 395; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 20 - 443
Target Start/End: Complemental strand, 36908886 - 36908463
Alignment:
| Q |
20 |
tagaaccaatgaaagaggaaaatggcgtccgagctaagtctagccctggtgattcagtgaagtctacgggattccgacaaaatggcagcaggcgtaaaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36908886 |
tagaaccaatgaaagaggaaaatggcgtccgagctaagtctagccctggtgattcagtgaagtctacgggattccgacaaaatggcagcaggcgtaaaag |
36908787 |
T |
 |
| Q |
120 |
caagcctcaccgtgctgctgaagctggtgtagattgcaagtgaacaaggttttttggtaatagtttcatgaccttggaattgccggaactctgctatcac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36908786 |
caagcctcaccgtgctgctgaagctggtgtagattgcaagtgaacaaggttttttggtaatagtttcatgaccttggaattgccggaactctgctatcac |
36908687 |
T |
 |
| Q |
220 |
aagtcagggtttgtttgattatataaggcttgttatggttgcttcttattattattgtaactttcatatgcttattccnnnnnnngaggcttattttagc |
319 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36908686 |
atgtcagggtttgtttgattatataaggcttgttatggttgcttcttattattattgtaactttcatatgcttattccaaaaaaagaggcttattttagc |
36908587 |
T |
 |
| Q |
320 |
tctgaggattcatagtaagactatgcttctatagtcttctatagagagatactatcctaaaaggaattattgaaattttgtagatattcttttatcatgg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36908586 |
tctgaggattcatagtaagactatgcttctatagtcttctatagagagatactatcctaaaaggaactattgaaattttgtagatattcttttatcatgg |
36908487 |
T |
 |
| Q |
420 |
gtttgtataaactgatttcctctt |
443 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36908486 |
gtttgtataaactgatttcctctt |
36908463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 36904036 - 36903993
Alignment:
| Q |
389 |
ttgaaattttgtagatattcttttatcatgggtttgtataaact |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904036 |
ttgaaattttgtagatattcttttatcatgggtttgtataaact |
36903993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University