View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_low_33 (Length: 324)
Name: NF7826_low_33
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 6 - 308
Target Start/End: Complemental strand, 14545098 - 14544794
Alignment:
| Q |
6 |
aaagaaagaaaggatttaagggggg-accataaattcatcaagctcgggatcggctccaaaacacgtggaaacaacaacgtctcttttacacatatcgtt |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545098 |
aaagaaagaaaggatttaagggggggaccataaattcatcaagctcgggatcggctccaaaacacgtggaaacaacaacgtctcttttacacatatcgtt |
14544999 |
T |
 |
| Q |
105 |
ttctcttcgaatctcttccaataaacttgcaatttcaggaggagcaccaacctaaacaatttattagcaattgcagaaattcgttaaactagattaagac |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
14544998 |
ttctcttcgaatctcctccaataaacttgcaatttcaggaggagcaccaacctaaacaatttattagcaattatagaaattcgttaaactggattaagac |
14544899 |
T |
 |
| Q |
205 |
cgtcacgttgcagagtagttacgatcaaacttagtttaa-tttaccttttgacaatcgatataggcttgaagaaggcgaggataataaggatgagaagca |
303 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14544898 |
cgtcacgttgcagagtagttacgatcagacttagtttaattttaccttttgacaatcgatataggcttgaagaaggcgagggtaataaggatgagaagca |
14544799 |
T |
 |
| Q |
304 |
atttt |
308 |
Q |
| |
|
||||| |
|
|
| T |
14544798 |
atttt |
14544794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University