View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_low_48 (Length: 249)
Name: NF7826_low_48
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 40054976 - 40054750
Alignment:
| Q |
1 |
acttatccaagaacatttggatgtggtataatagatttctctcaattgaagtaaagattttaggtttgaattcaactctgaaaatgtagctgtgttaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40054976 |
acttatccaagaacatttggatgtgatataatagatttctctcaatttaactaaagattttaggtttgaattcaactctgaaaatgtagctgtgttaaat |
40054877 |
T |
 |
| Q |
101 |
ttcttgagggaaagttttgccattcaatactgttttactaggtttaagatattagattctgtagttgcatgtagagatatctgattaaataaaaaacact |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
40054876 |
ttcttgagggaaagttttgccattcattactgttttactaggtttaagatattagattctgctgttgcacgtaga-------tattaaataaaaaacact |
40054784 |
T |
 |
| Q |
201 |
tggtactcttaccatgaatgattaaagagaatat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40054783 |
tggtactcttaccatgaatgattaaagagaatat |
40054750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University