View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7826_low_56 (Length: 234)
Name: NF7826_low_56
Description: NF7826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7826_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 149 - 217
Target Start/End: Original strand, 18674954 - 18675022
Alignment:
| Q |
149 |
agataaatatcatatatgatatccatcatggagtagcataaagtcatatatacttcaatccttaaccat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18674954 |
agataaatatcatatatgatatccatcaaggagtagcataaagtcatatatacttcaatccttaaccat |
18675022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 18674855 - 18674970
Alignment:
| Q |
17 |
aggtgtgacttaattctgtgataaacgctcttacgagaaaattggccattgctttgaagagaccatnnnnnnntgcgag--tttttatttttctatcacc |
114 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| | || ||||||||||||||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
18674855 |
aggtgtgagttaattttgtgataaacgctcttaagctgaa-ttggccattgctttgaagagaacataaaaaaatgcgagtttttttatttttctatcacc |
18674953 |
T |
|
| Q |
115 |
agataaatatcatatat |
131 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18674954 |
agataaatatcatatat |
18674970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University