View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7827_low_2 (Length: 296)
Name: NF7827_low_2
Description: NF7827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7827_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 277
Target Start/End: Complemental strand, 3016471 - 3016211
Alignment:
| Q |
17 |
taggatcaactatgttgtgcaactcattgatttttaggactattacttacaaggtgaagcttgataagaatttcacatcacacatttacatttaccttca |
116 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016471 |
taggatcaactatattgtgcaactgattgatttttaggactattacttactaggtgaagcttgataagaatttcacatcacacatttacatttaccttca |
3016372 |
T |
 |
| Q |
117 |
aaaggcaaacgtgaaatatgtaatatgagttgcttattgatttcatcttgcatataacgacaacaatgatcggtcaattgtttaacaaaattgaaaccaa |
216 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| || | |
|
|
| T |
3016371 |
aaaggcaaacatgaaatatgtaatgtgagctgcttattgatttcatcttgcatataacggcaacaatgatcggccaattgtttaacaaaattgatactat |
3016272 |
T |
 |
| Q |
217 |
gttttctctctccattgaatagcttgggtagaattcaatcaatgtgaagcttacgacgatg |
277 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
3016271 |
gttttctctctaaattgaatagcttggatagaattcaatcaatgtgaagcttacgatgatg |
3016211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 77 - 210
Target Start/End: Complemental strand, 3021565 - 3021432
Alignment:
| Q |
77 |
ttgataagaatttcacatcacacatttacatttaccttcaaaaggcaaacgtgaaatatgtaatatgagttgcttattgatttcatcttgcatataacga |
176 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||||||||||| ||| ||||||| ||| |||||| || ||||| ||||||| ||||||||| || |
|
|
| T |
3021565 |
ttgataaaaatttcatatcacacatttgcatttaccttcaaaaggtaaatgtgaaatgtgtgatatgatctgtttattcatttcattttgcatatagcgg |
3021466 |
T |
 |
| Q |
177 |
caacaatgatcggtcaattgtttaacaaaattga |
210 |
Q |
| |
|
| |||||||| ||||||| |||||| |||||| |
|
|
| T |
3021465 |
cgccaatgatcagtcaattacttaacacaattga |
3021432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University