View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7827_low_5 (Length: 203)
Name: NF7827_low_5
Description: NF7827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7827_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 51404732 - 51404548
Alignment:
| Q |
1 |
ctcgggatgattctacaaggttgattagtgtagggatgttgcgtgtgctgtggaaacatgccaagactctgagctctgattcttgatctttgcgttggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51404732 |
ctcgggatgattctacaaggttgattagtgtagggatgttgcgtgtgctgtggaaacatgccaagactctgagctctgattcttgatctttgcgttggac |
51404633 |
T |
|
| Q |
101 |
tgttttgtgtttataaggtgctcctcttcgagctggtttgtatactgccatcactattggggtggtgatgaaggttgtgaataat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51404632 |
tgttttgtgtttataaggtgctcctcttcgagctggtttgtatactgccatcactattggggtggtgatgaaggttgtgaataat |
51404548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 117 - 180
Target Start/End: Original strand, 29982085 - 29982148
Alignment:
| Q |
117 |
ggtgctcctcttcgagctggtttgtatactgccatcactattggggtggtgatgaaggttgtga |
180 |
Q |
| |
|
|||| |||||| | ||||||||| || ||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
29982085 |
ggtgatcctctcctagctggtttatacactgccatcactattggtgtggtaatgaaagttgtga |
29982148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 181
Target Start/End: Complemental strand, 40071602 - 40071550
Alignment:
| Q |
129 |
cgagctggtttgtatactgccatcactattggggtggtgatgaaggttgtgaa |
181 |
Q |
| |
|
|||||||| ||||| | ||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
40071602 |
cgagctggattgtagattgccatcaccactggggttgtgatgaaggttgtgaa |
40071550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University