View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_high_12 (Length: 224)
Name: NF7828_high_12
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4857993 - 4857779
Alignment:
| Q |
1 |
gatcaaaacagaggtgaatttgaattcaaattccatgaatccaacatcacacaagtagacctgatatctgtcaaccagaagaaaacaagcaaacatcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4857993 |
gatcaaaacagaggtgaatttgaattaaaattctatgaatccaacatcacacaagtagacctgatatctgtcaaccagaagaaaacaagcaaacatcagc |
4857894 |
T |
 |
| Q |
101 |
ataaataaacttagataaactaggtatgtaaacggcgccggagta-ggtactccccatccccgccgtccagaattttctccatccacgtctccattccct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4857893 |
ataaataaacttagataaactaggtatgtaaacggcgccggagtagggtactccccatccccgcagtccaaaattttctccatccacgtctccattccct |
4857794 |
T |
 |
| Q |
200 |
attttgaggagtatt |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4857793 |
attttgaggagtatt |
4857779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University