View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_high_13 (Length: 220)
Name: NF7828_high_13
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 42 - 180
Target Start/End: Complemental strand, 34306606 - 34306468
Alignment:
| Q |
42 |
gtattgtgctacttcatataatacagttgttttcatcatttatgtatagaaaaagataaaatcatttaatacttttcaaactgacatgttattgttttta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306606 |
gtattgtgctacttcatataatacagttgttttcatcatttatgtatagaaaaagataaaatcatttaatacttttcaaactgacatgttattgttttta |
34306507 |
T |
 |
| Q |
142 |
ttctacaaatttacatataaaagaaatgctcacacaact |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306506 |
ttctacaaatttacatataaaagaaatgctcacacaact |
34306468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University