View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_high_6 (Length: 269)
Name: NF7828_high_6
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 24766222 - 24766462
Alignment:
| Q |
20 |
attatgggcattttgtggagcaagcgttggtggcatcatgggatttttacgatggaggactttgttggatgcatgttatttttagttttaggtttcagaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
24766222 |
attatgggcattttgtggagcaagcgttggtggcatcatgggatttttacgatggaggactttgttggatgtatgttatttttagttttaagtttcagaa |
24766321 |
T |
|
| Q |
120 |
gtttgtttcatgttataaagactataatttgttcttcagtagtttaattatcgtttgatgtttaagatttgtctaagcctccagaattggttttgggttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24766322 |
gtttgtttcatgttataaagactataatttgttcttcagtagtttaattatcgtttgatgtttaagatttgtctaagcctccagaattggttttgggttc |
24766421 |
T |
|
| Q |
220 |
atatgttgcaagtttttcaacttttgtttcataagtattat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24766422 |
atatgttgcaagtttttcaacttttgtttcataagtattat |
24766462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University