View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_low_14 (Length: 247)
Name: NF7828_low_14
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 4857620 - 4857371
Alignment:
| Q |
1 |
ttttttacatataaaagaaatctatacacttattgtgtggaaagacaaataaatataacatttataagttatttcag------------aggtagggtct |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||| |
|
|
| T |
4857620 |
ttttttacatataaaagaaatctatacaattattgtgtggaaagacaaataaatataacatctataagttattttagtaaactgtttagaggtagggtct |
4857521 |
T |
 |
| Q |
89 |
ctatggagttggtgaactttcgttctcgtcctcgtgaggaaagccttctcgccaacgagggcttaaatggggcagtttctacggagatccccacttacat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||| |
|
|
| T |
4857520 |
ctatggagttggtgaactttcgttctcgtcctcgtgaggaaagccttctcgccaacgagggctcaaatggggcaatttccacggagatccccacttacac |
4857421 |
T |
 |
| Q |
189 |
gtacaaattgacatacctagataaatgtcaaacattccaacttggatatt |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4857420 |
gtacaaattgacatccctagataaatgtcaaacatttcaacttggatatt |
4857371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University