View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_low_16 (Length: 239)
Name: NF7828_low_16
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 160 - 223
Target Start/End: Complemental strand, 4745058 - 4744995
Alignment:
| Q |
160 |
attgtgaaattcgtataaaaatattatatggtgggataagaagcatgtgcagcaatgccacatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4745058 |
attgtgaaattcgtataaaaatattatatgatgggataagaagcatgtgcagcaatgccacatt |
4744995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 4745141 - 4745098
Alignment:
| Q |
43 |
atataggcagaatttcaatacaatataagcacgaacacgaagaa |
86 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4745141 |
atataagcagaatttcagtacaatataagcacgaatacgaagaa |
4745098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University