View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7828_low_17 (Length: 237)

Name: NF7828_low_17
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7828_low_17
NF7828_low_17
[»] chr4 (2 HSPs)
chr4 (1-223)||(45735674-45735895)
chr4 (1-205)||(45746923-45747126)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 45735674 - 45735895
Alignment:
1 ccaagaggaaatctggaaaagtggaaaatgacgttgataattcgagtttggctttgagtggaatggttcgttttgataatgttgttggtttggctgagcc 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
45735674 ccaagaggaaatctggaaaagtggaaagtgacgttgataattcgagtttggctttgagtggaatggttcgttttgataattttgttggtttggctgagcc 45735773  T
101 gaacaaagatgatgcnnnnnnnnggcttggaattgatgggggaatcaaagagagttgtgctgggggacaggtcgaggaatttcagtatattctcttgttg 200  Q
    |||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45735774 gaacaaagatgatgc-aaaaaagggcttggaattgatgggggaatcaaagagagttgtgctgggggacaggtcgaggaatttcagtatattctcttgttg 45735872  T
201 aacatccaccgataggatatttt 223  Q
    |||||||||||||||||||||||    
45735873 aacatccaccgataggatatttt 45735895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 45746923 - 45747126
Alignment:
1 ccaagaggaaatctggaaaagtggaaaatgacgttgataattcgagtttggctttgagtggaatggttcgttttgataatgttgttggtttggctgagcc 100  Q
    |||||| ||||||||||||||| ||| |||| ||||||||||| |||||||||||||||| ||||||| ||| |||||||  ||| |||||||||| ||     
45746923 ccaagaagaaatctggaaaagttgaagatgatgttgataattcaagtttggctttgagtgaaatggtttgttgtgataattctgtgggtttggctgggct 45747022  T
101 gaacaaagatgatgcnnnnnnnnggcttggaattgatgggggaatcaaagagagttgtgctgggggacaggtcgaggaatttcagtatattctcttgttg 200  Q
    |||||||||||  ||        ||||| ||||||||||||||||||||||| |||||| ||| ||| |||  |||||| || |||||||| ||||| ||    
45747023 gaacaaagatgccgc-gaaaaggggctttgaattgatgggggaatcaaagagggttgtgttggaggataggaggaggaagttaagtatattatcttgctg 45747121  T
201 aacat 205  Q
    |||||    
45747122 aacat 45747126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University