View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7828_low_18 (Length: 236)
Name: NF7828_low_18
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7828_low_18 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 45735681 - 45735445
Alignment:
| Q |
1 |
cctcttggtaactaattctttctttgcagaaccattgttttt-aatagtagcgtccctcttcgaactctttagagttttcccattagtttttcagttttc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45735681 |
cctcttggtaactaattctttctttgcagaaccactgttttttaatagtagcgtccttcttcgaactctttagagttttcccattagtttttcagttttc |
45735582 |
T |
|
| Q |
100 |
ttcaacttcattgggttcattattgtcccaaacctttttgaaaagttcaaacgattttttgtcacgggatttagtaaaattgtcaccggtttcaaactac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45735581 |
ttcaacttcattgggttcattattgtcccaaacctttttgaaaagttcaaacgattttttgtcacgggatttagtaaaattgtcaccggtttcaaactac |
45735482 |
T |
|
| Q |
200 |
ttcagactacaaaccttctgctttagttgttcgctga |
236 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
45735481 |
ttcagactataaaccttctgttttagttgttcgctga |
45735445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 3 - 194
Target Start/End: Complemental strand, 45746928 - 45746737
Alignment:
| Q |
3 |
tcttggtaactaattctttctttgcagaaccattgtttttaatagtagcgtccctcttcgaactctttagagttttcccattagtttttcagttttcttc |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| |||||||||| ||| |||| ||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
45746928 |
tcttggtaactaattctttcttagcagaaccacggtttctaatagtagcatccttcttagaactctttggagttttcccattaatttttccgttttcttc |
45746829 |
T |
|
| Q |
103 |
aacttcattgggttcattattgtcccaaacctttttgaaaagttcaaacgattttttgtcacgggatttagtaaaattgtcaccggtttcaa |
194 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||| ||||||||||| |||||||||| |||||| || |||||||| |
|
|
| T |
45746828 |
ggcttcattgggtccattattgccccaaaccttattgaaaagtacaaacctttttttgtcacaggatttagtataattgttactggtttcaa |
45746737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University