View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7828_low_19 (Length: 224)

Name: NF7828_low_19
Description: NF7828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7828_low_19
NF7828_low_19
[»] chr2 (1 HSPs)
chr2 (1-214)||(4857779-4857993)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4857993 - 4857779
Alignment:
1 gatcaaaacagaggtgaatttgaattcaaattccatgaatccaacatcacacaagtagacctgatatctgtcaaccagaagaaaacaagcaaacatcagc 100  Q
    |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4857993 gatcaaaacagaggtgaatttgaattaaaattctatgaatccaacatcacacaagtagacctgatatctgtcaaccagaagaaaacaagcaaacatcagc 4857894  T
101 ataaataaacttagataaactaggtatgtaaacggcgccggagta-ggtactccccatccccgccgtccagaattttctccatccacgtctccattccct 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||    
4857893 ataaataaacttagataaactaggtatgtaaacggcgccggagtagggtactccccatccccgcagtccaaaattttctccatccacgtctccattccct 4857794  T
200 attttgaggagtatt 214  Q
    |||||||||||||||    
4857793 attttgaggagtatt 4857779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University