View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_high_29 (Length: 283)
Name: NF7829A_high_29
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 4 - 261
Target Start/End: Original strand, 35410368 - 35410625
Alignment:
| Q |
4 |
cgcgggctggtgcatttgtcttgagtgtgtatcgcatatggggatgcaaaagcttgaatacaggatgcatcacgcttaattgccgatgagctgcaattat |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410368 |
cgcgggctgttgcatttgtcttgagtgtgtatcgcatatggggatgcagaagcttgaatacaggatgcatcacgcttaattgccgatgagctgcaattat |
35410467 |
T |
 |
| Q |
104 |
taatggttccatgcatgcgtgtattcttaacctgttcggttatcataggtcaaatgtcattactaaatttctaaaacaaaagttttggtcaagtttttct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35410468 |
taatggttccatgcatgcgtgtattcttaacctgttcggttatcataggtcaaatgtcattactaaatttctaaaacaaaagttttgggcaagtttttct |
35410567 |
T |
 |
| Q |
204 |
caaatacatatatttgcatggaaatagtaattcataccaatggtgcacaagtgtatga |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35410568 |
caaatacatatatttgcatggaaataataattcataccaatggtgcacaagtgtatga |
35410625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University