View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_high_36 (Length: 247)
Name: NF7829A_high_36
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 24 - 122
Target Start/End: Complemental strand, 30103174 - 30103076
Alignment:
| Q |
24 |
agtaccttttttcttggcatataccattaggtgaatttgagagggaaaacgatggtggaggagttgttcttctggaagggaagcaacaacccaaaccca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30103174 |
agtaccttttttcttggcatataccattaggtgaatttgagagggaaaacgatggtggaggagttgttcttctggaagggaagcaacaacccaaaccca |
30103076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 197 - 247
Target Start/End: Complemental strand, 30102991 - 30102941
Alignment:
| Q |
197 |
atacaattttacttgtctgaatttttgttgttaaatcaatcttatgaataa |
247 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30102991 |
atacaattttacttgtttgaatttttgttgttaaatcaatcttatgaataa |
30102941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University