View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_113 (Length: 346)
Name: NF7829A_low_113
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 85 - 330
Target Start/End: Original strand, 28795638 - 28795882
Alignment:
| Q |
85 |
tcaaaggtagatcaattgttgaacaacggtggtgaaagtggtgattgaggatggttgaagtagcggttggtggtggtcagagtggtggttaaattggaga |
184 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28795638 |
tcaaaggtgaataaattgttgaacagcggtggtgaaagtggtgattgaggatggttgaagtagcggttggtggttgtcagagtggtggttaaattggaga |
28795737 |
T |
 |
| Q |
185 |
tcaaagatgaatagagtgttgatcagaattgaggtccaaggcagatgttgttttgttggcctaccccttgggtcaggtatgaattagacatagacgacta |
284 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28795738 |
tcaagg-tgaatagagtgttgatcagaattgaggtccaaggcatatgttgttttgttggcctaccccttgggtcaggtatgaattagacatagacgacta |
28795836 |
T |
 |
| Q |
285 |
aacctgtgagacatgcactcacatacttttggatatttttatgatg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28795837 |
aacctgtgagacatgcactcacatacttttggatatttttacgatg |
28795882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University